Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 21: Problem 11

Explain why decapping and deadenylation are common mechanisms involved in RNA decay.

Short Answer

Expert verified
Answer: Decapping and deadenylation are two mechanisms that facilitate the degradation of messenger RNA (mRNA) molecules in cells. Decapping is a process in which the 5' cap structure of an mRNA molecule is removed, exposing the mRNA to exonucleases for degradation. Deadenylation is the process of removing the poly(A) tail from the 3' end of an mRNA molecule, weakening its protection and making it more susceptible to degradation. These processes cooperate to ensure efficient mRNA degradation, contributing to cellular homeostasis and the regulation of gene expression.

Step by step solution

01

Introduction

In eukaryotic cells, messenger RNA (mRNA) plays a crucial role in conveying genetic information from the DNA in the nucleus to the ribosomes in the cytoplasm for protein synthesis. However, mRNA molecules are not meant to last indefinitely – they are eventually degraded to maintain cellular homeostasis and regulate gene expression. Two common mechanisms involved in mRNA decay are decapping and deadenylation.
02

Decapping

Decapping is a process in which the 5' cap structure of an mRNA molecule is removed. The 5' cap is a modified guanine nucleotide that protects the mRNA from degradation by exonucleases and promotes mRNA stability. By removing the 5' cap, decapping exposes the mRNA to exonucleases, which rapidly degrade the mRNA molecule from the 5' end. Thus, decapping acts as a "trigger" for mRNA degradation by exposing the vulnerable ends of the mRNA molecule to cellular exonucleases.
03

Deadenylation

Deadenylation is the process of removing the poly(A) tail from the 3' end of an mRNA molecule. The poly(A) tail is a long stretch of adenine nucleotides added to the 3' end of an mRNA molecule, playing a key role in protecting the mRNA from degradation by exonucleases and promoting mRNA stability. Deadenylation shortens the poly(A) tail, weakening the protection it provides and making the mRNA more susceptible to degradation by 3' to 5' exonucleases. Furthermore, deadenylation decreases the mRNA's affinity for poly(A) binding proteins (PABPs), which can also destabilize the mRNA transcript.
04

Mutual Cooperation Between Decapping and Deadenylation

Decapping and deadenylation often occur together in mRNA decay pathways, as they both facilitate mRNA degradation by targeting the protective features of the mRNA molecule. Deadenylation typically occurs before decapping, as it weakens the mRNA's structure, making it more susceptible to decapping and degradation. Thus, decapping and deadenylation cooperate to ensure efficient mRNA degradation and to maintain proper gene expression levels within the cell.
05

Conclusion

In conclusion, decapping and deadenylation are common mechanisms involved in RNA decay because they target the protective features of mRNA molecules, facilitating their degradation. By working together, these processes ensure efficient mRNA degradation, contributing to cellular homeostasis and the regulation of gene expression.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Explain how the spliceosome recognizes introns.

TATA-less promoters do not contain a recognizable TATA box but are still associated with TBP. What features are often found in these promoters?

The DNA sequence of a gene follows. If this is the sense strand, write the sequence of the mRNA transcript formed. CGCGGATCCTTGAATTCTAAATAAACCATTT ACCACCATGACC

Why does tRNA contain more types of base modifications than rRNA?

Why is it beneficial for organisms to have more than one copy of rRNA genes in the genome? Why do more complex organisms tend to have more copies of these genes?
See all solutions

Recommended explanations on Biology Textbooks

Biology Experiments

Read Explanation

Bioenergetics

Read Explanation

Cell Communication

Read Explanation

Biological Structures

Read Explanation

Cell Cycle

Read Explanation

Genetic Information

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free