Chapter 21: Problem 9
TATA-less promoters do not contain a recognizable TATA box but are still associated with TBP. What features are often found in these promoters?
Chapter 21: Problem 9
TATA-less promoters do not contain a recognizable TATA box but are still associated with TBP. What features are often found in these promoters?
All the tools & learning materials you need for study success - in one app.
Get started for freeThe DNA sequence of a gene follows. If this is the sense strand, write the sequence of the mRNA transcript formed. CGCGGATCCTTGAATTCTAAATAAACCATTT ACCACCATGACC
Why is it beneficial for organisms to have more than one copy of rRNA genes in the genome? Why do more complex organisms tend to have more copies of these genes?
Why do bacteria contain multiple \(\sigma\) factors?
How does the mechanism of group I introns differ from that of group II introns? Which is more similar to the spliceosome-catalyzed reaction?
Why is the phosphorylation state of the RNA polymerase II CTD an important component of transcription? Describe the changes that the CTD undergoes from initiation to termination.
What do you think about this solution?
We value your feedback to improve our textbook solutions.