In any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20

b. 40

c. 100

d. 200

Short Answer

Expert verified

There is at least one type of amino-acyl tRNAsynthetase for every 20 amino acids in a given species.

Step by step solution

01

step-1: Introduction

A tRNA-ligase, also known as an aminoacyl-tRNA synthetase (aaRS or ARS), is an enzyme that connects the proper amino acid to its associated tRNA.

02

step-2: Explanation of correct answers

Option (a) 20. The amino-acyl tRNA synthetase enzyme is in charge of the tRNA charging process, which connects the tRNA molecule to the appropriate amino acid. In general, this enzyme is present in at least one group for each of the 20 amino acids. This number may vary by species, but it must be at least 20 for any species to be considered.

03

step-3: Explanation of incorrect answers

Option (b) 40 is an alternative to option (a). The amino-acyl synthetase enzyme is responsible for the production of 20 amino acids by mRNAs throughout the transcription and translation process. As a result, all species has at least 20 amino acids, which may vary depending on the species.

Option (c) is worth a hundred dollars. The amino-acyl synthetase enzyme is responsible for the production of 20 amino acids by mRNAs throughout the transcription and translation process. As a result, all species has at least 20 amino acids, which may vary depending on the species.

Option (d) 200 is a good choice. The amino-acyl synthetase enzyme is responsible for the production of 20 amino acids by mRNAs throughout the transcription and translation process. As a result, all species has at least 20 amino acids, which may vary depending on the species.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

The -10 and -35 regions of prokaryotic promoters are called consensus sequences because ________.

a. they are identical in all bacterial species b. they are similar in all bacterial species

c. they exist in all organisms

d. they have the same function in all organisms

How do enhancers and promoters differ? a. Enhancers bind transcription factors to silence gene expression, while promoters activate transcription. b. Enhancers increase the efficiency of gene expression but are not essential for transcription. Promoter recognition is essential to transcription initiation. c. Promoters bind transcription factors to increase the efficiency of transcription. Enhancers bind RNA polymerases to initiate transcription. d. There is no difference. Both are transcription factor-binding sequences in DNA.

How do enhancers and promoters differ?

a. Enhancers bind transcription factors to silence gene expression, while promoters activate transcription.

b. Enhancers increase the efficiency of gene expression, but are not essential for transcription. Promoter recognition is essential to transcription initiation.

c. Promoters bind transcription factors to increase the efficiency of transcription. Enhancers bind RNA polymerases to initiate transcription.

d. There is no difference. Both are transcription factor-binding sequences in DNA.

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free