A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?

Short Answer

Expert verified

The Met CysArgAsn Ser Arg amino acid is produced by translating the provided mRNA sequence -CUAUGUCGUAACAGCCGAUGACCCG.

Step by step solution

01

step-1: Definition

The core dogma is the transfer of genetic information from DNA to mRNA to protein in the cell. The nucleotides in mRNAs are read in a group of three nucleotides termed codons by the cell. During the production of polypeptides, mRNA codons are read from 5'3'direction. During the transcription and translation processes in ribosomes, decoding of one molecule to another is accomplished with the help of specific proteins and RNAs.

02

step-2: Introduction

The genetic codes are the complete collection of relationships between codons and amino acids. With the exception of three codons, the genetic code is made up of 64 triplets of nucleotides, each of which encodes for one of the 20 amino acids used in protein production.

03

step-3: Explanation

Each codon consists of a triplet of any nitrogenous base that corresponds to a specific amino acid.

Codons have special properties based on nitrogenous bases, such as complementarity, universality, and degeneracy. The coding table's arrangements describe the structure of genetic code and are in charge of instructing the protein synthesis process.

For the translation of an mRNA sequence with few instructions to comprehend:

Look for the AUG start codon, which identifies Methionine and suggests translation.

Read each code in a pair of threes after selecting AUG code, as codons are a set of three alphabets.

Each triplet represents a different amino acid, which is listed in the coding table.

UAA, UAG, and UGA are nonsense codons that must stop translation of sequence

Follow the methods above to translate the following sequence: CUAUGUCGUAACAGCCGAUGACCCG.

AUG is found as a methionine following the first two letters of CU. UGU-Cys, CGU-Arg, AAC-Asn, AGC-Ser, CGA-Arg, UGA-Stop codon may be found by further separating the sequence into three letters: UGU-Cys, CGU-Arg, AAC-Asn, AGC-Ser, CGA-Arg, UGA-Stop codon.

We had stopped translating after receiving UGA because it is a stop codon.

Finally, from the supplied sequence of CUAUGUCGUAACAGCCGAUGACCCG, we discovered the amino acid sequence as- Met CysArgAsn Ser Arg.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.

Sign-up for free