Chapter 15: Q. 11 (page 392)
What transcripts will be most affected by low levels of α-amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAs
Short Answer
Option b is correct.
Chapter 15: Q. 11 (page 392)
What transcripts will be most affected by low levels of α-amanitin? a. 18S and 28S rRNAs b. pre-mRNAs c. 5S rRNAs and tRNAs d. other small nuclear RNAs
Option b is correct.
All the tools & learning materials you need for study success - in one app.
Get started for freeHow many nucleotides are in 12 mRNA codons?
a. 12
b. 24
c. 36
d. 48
Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'
Which pre-mRNA processing step is important for initiating translation?
a. poly-A tail
b. RNA editing
c. splicing
d. 7-methylguanosine cap
A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?
a. complementarity
b. nonsense codons
c. universality
d. degeneracy
What do you think about this solution?
We value your feedback to improve our textbook solutions.