Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 15: Q. 16 (page 392)

The RNA components of ribosomes are synthesized in the ________. a. cytoplasm b. nucleus c. nucleolus d. endoplasmic reticulum

Short Answer

Expert verified

Option c is correct.

Step by step solution

01

Step 1. Introduction

The process through which information encoded in mRNA is translated into amino acid during protein synthesis is known as translation.

02

Step 2. Explanation of the correct option

Option c is correct because ribosomal RNA is synthesized from transfer RNA in a specialized region of the cell called the nucleolus.

03

Step 3. Explanation of the incorrect option

Option a is incorrect because RNA is synthesized in nucleolus instead of cytoplasm.

Option b is incorrect because RNA is synthesized in the nucleolus instead of the nucleus.

Option d is incorrect because RNA is synthesized in the nucleolus instead of the endoplasmic reticulum.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What transcripts will be most affected by low levels of αamanitin?

a. 18S and 28S rRNAs

b. pre-mRNAs

c. 5S rRNAs and tRNAs

d. other small nuclear RNAs

Which feature of promoters can be found in both prokaryotes and eukaryotes?

a. GC box

b. TATA box

c. octamer box

d. -10 and -35 sequences

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Which event contradicts the central dogma of molecular biology?

a. Poly-A polymerase enzymes process mRNA in the nucleus.

b. Endonuclease enzymes splice out and repair damaged DNA.

c. Scientists use reverse transcriptase enzymes to make DNA from RNA.

d. Codons specifying amino acids are degenerate and universal.

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?

a. complementarity

b. nonsense codons

c. universality

d. degeneracy
See all solutions

Recommended explanations on Biology Textbooks

Organ Systems

Read Explanation

Cells

Read Explanation

Ecological Levels

Read Explanation

Biological Processes

Read Explanation

Cellular Energetics

Read Explanation

Bioenergetics

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free