Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 15: Q. 17 (page 392)

In any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20 b. 40 c. 100 d. 200

Short Answer

Expert verified

Option a is correct.

Step by step solution

01

Step 1. Introduction

Aminoacetyl tRNA is a substrate of translation and it plays a significant role in determining how genetic cod are read and interpreted as an amino acids.

02

Step 2. Explanation of the correct option

Option a is correct because there are a total of 20 aminoacyl tRNA synthetases.

03

Step 3. Explanation of the incorrect option

Option b is correct because there are a total of 20 aminoacyl tRNA synthetases instead of 40.

Option c is correct because there are a total of 20 aminoacyl tRNA synthetases instead of 100.

Option d is correct because there are a total of 20 aminoacyl tRNA synthetases instead of 200.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?

What transcripts will be most affected by low levels of αamanitin?

a. 18S and 28S rRNAs

b. pre-mRNAs

c. 5S rRNAs and tRNAs

d. other small nuclear RNAs

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated

Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?

Which event contradicts the central dogma of molecular biology?

a. Poly-A polymerase enzymes process mRNA in the nucleus.

b. Endonuclease enzymes splice out and repair damaged DNA.

c. Scientists use reverse transcriptase enzymes to make DNA from RNA.

d. Codons specifying amino acids are degenerate and universal.
See all solutions

Recommended explanations on Biology Textbooks

Cellular Energetics

Read Explanation

Ecological Levels

Read Explanation

Ecology

Read Explanation

Biological Structures

Read Explanation

Microbiology

Read Explanation

Substance Exchange

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free