Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 15: Q. 21 (page 392)

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated

Short Answer

Expert verified

Met Cys Arg Asn Ser Arg

Step by step solution

01

Step 1. Introduction

The process through which information encoded in mRNA is translated into amino acid during protein synthesis is known as translation.

02

Step 2. Explanation

Amino acids writing first begins with the start codon AUG. Then the nucleotide sequences are separated in triplets. Then these triplets are translated into amino acids and translation stops at stop codon UGA.

Codon mention in question will for sequence Met Cys Arg Asn Ser Arg.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

What transcripts will be most affected by low levels of αamanitin?

a. 18S and 28S rRNAs

b. pre-mRNAs

c. 5S rRNAs and tRNAs

d. other small nuclear RNAs

Which feature of promoters can be found in both prokaryotes and eukaryotes?

a. GC box

b. TATA box

c. octamer box

d. -10 and -35 sequences

Figure 15.13Errors in splicing are implicated in cancers and other human diseases. What kinds of mutations might lead to splicing errors? Think of different possible outcomes if splicing errors occur.

A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect ?
See all solutions

Recommended explanations on Biology Textbooks

Communicable Diseases

Read Explanation

Ecosystems

Read Explanation

Cell Communication

Read Explanation

Responding to Change

Read Explanation

Heredity

Read Explanation

Reproduction

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free