A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated

Short Answer

Expert verified

Met Cys Arg Asn Ser Arg

Step by step solution

01

Step 1. Introduction

The process through which information encoded in mRNA is translated into amino acid during protein synthesis is known as translation.

02

Step 2. Explanation

Amino acids writing first begins with the start codon AUG. Then the nucleotide sequences are separated in triplets. Then these triplets are translated into amino acids and translation stops at stop codon UGA.

Codon mention in question will for sequence Met Cys Arg Asn Ser Arg.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free