A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

Short Answer

Expert verified

Met – Val – Ile – Thr – His – Glu – Ala (Original mRNA translation)

Met – Val – Asn – Asn – Thr (mutated mRNA translation)

Step by step solution

01

Step 1. Introduction

The translation is a process of protein synthesis in which information encoded in mRNA is directs the addition of amino acids during protein synthesis.

02

Step 2. Explanation

Original mRNA reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’

It is translated to form Met – Val – Ile – Thr – His – Glu – Ala;

While mutated mRNA reads 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’

It is translated to form Met – Val – Asn – Asn – Thr;

Insertion of the nucleotide can have a dramatic effect as it shifts the frame for codon which alters the amino acids encoded by the mRNA, as a result, it led to the addition of premature stop or start sites.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free