Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 15: Q.27 (page 393)

Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'

Short Answer

Expert verified

The mRNA would be: 5' - AUGGCCGGUUAUUAAGCA - 3'

Step by step solution

01

Step1. Introduction

DNA translation is the term used to describe the process of protein synthesis by ribosomes in the cytoplasm or endoplasmic reticulum.

Transcription is the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

02

Step2. Explanation

  1. The mRNA would be: 5' - AUGGCCGGUUAUUAAGCA - 3';
  2. AUG - Met, GCC - Ala, GGU - Gly, UAU - Tyr, UAA - Stop, GCA - Ala;
  3. The corresponding protein would be: MAGY;
  4. Although there are six codons, only four would be translated because the fifth codon is a stop codon. Therefore, sixth wouldn't be translated.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.

The -10 and -35 regions of prokaryotic promoters are called consensus sequences because ________.

a. they are identical in all bacterial species b. they are similar in all bacterial species

c. they exist in all organisms

d. they have the same function in all organisms

In your own words, describe the difference between rho dependent and rho-independent termination of transcription in prokaryotes.

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Which subunit of the E. coli polymerase confers specificity to transcription?

a. α

b. β

c. β'

d. σ
See all solutions

Recommended explanations on Biology Textbooks

Responding to Change

Read Explanation

Cell Communication

Read Explanation

Bioenergetics

Read Explanation

Plant Biology

Read Explanation

Control of Gene Expression

Read Explanation

Substance Exchange

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free