In addition to the standard base-paired helical structures (e.g., Fig. 24-2), DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson-Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.

Short Answer

Expert verified

The cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC is given below:

Step by step solution

01

Definition of Concept

The cruciform structure is similar to the X shape. It is made up of inverted repeats.

Inverted repeats are single-strand sequences that are followed downstream by an inverted version of themselves.

02

Step 2:Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC

In the given sequence, we must find the part of an inverted repeat: TCAAGTCCACGGTGGACTTGC.

We can accomplish this by joining the sequence's end and beginning. For example, in this case, the starting point is T and the ending base is C. They are unable to form Watson-Crick pairs (Watson-Crick pairs only include C.G and T.A).

As a result, we continue to test bases from beginning to end until we find Watson-Crick pairs.

TCAAGTCCA CGGTGGACTTGC is the inverted repeat for cruciform structure.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free