Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 3: Q20CP (page 76)

What is a DNA library and how can it be screened for a particular gene?

Short Answer

Expert verified

The DNA library is a collection of all of an organism's genes. It is very useful in determining the function of a particular gene.

Step by step solution

01

DNA library

A DNA library is a collection of DNA fragments cloned into vectors. Each gene is separated from the genome and replicated in a bacterial cell colony with the same vector DNA as the original.

cDNA library is commonly obtained by converting mRNA to cDNA (complementary DNA). After that, restriction enzymes extract each gene and clone it into a specific bacterial cell.

02

DNA library screened for particular gene

The cDNA library contains only exons or coding sequences since it comprises cDNA.Thus, the researchers may separate and examine the DNA fragments that interest them.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Question: Summarize the steps required to amplify a given segment of DNA in vivo and in vitro.

Why do the smallest fragments of DNA move the farthest during electrophoresis?

Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG

Why do cDNA libraries derived from different cell types within the same organism differ from each other?

Question: Explain how site-directed mutagenesis can be used to produce an altered protein in bacterial cells.
See all solutions

Recommended explanations on Biology Textbooks

Organ Systems

Read Explanation

Energy Transfers

Read Explanation

Ecology

Read Explanation

Heredity

Read Explanation

Cells

Read Explanation

Bioenergetics

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free