Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 27: Q10CP (page 995)

Why is proofreading necessary during aminoacylation?

Short Answer

Expert verified

Proofreading is necessary during aminoacylation as it increases the accuracy of the amino acids attached to the tRNA.

Step by step solution

01

Charging tRNA

The charging of tRNA or aminoacylation is a two-step process where the first step involves the activation of amino acids and then the second, the transfer of the activated amino acid moiety to tRNA.

02

Proofreading

The aminoacyl tRNA synthetase then hydrolyzes the mismatched amino acids either before transferring them to the tRNA or after they are wrongly transferred. It is therefore water-mediated lysis of the wrongly charged tRNA and activated amino acids.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A double stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).

AGATCGGATGCTCAACTATATATGTGATTAACAGAGCATGCG-GCATAAACT

(a). Identify the DNA sequence that encodes each peptide.

(b). Determine the amino acid sequence of each peptide.

(c). In a mutual viral strain, the T at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S rRNA residues A1492 and A1493 as are induced by codon–anticodon pairing (Fig. 27-32). Propose an explanation for the antibiotic effect of paromomycin.

Genetically engineered mRNAs that code for a stretch of basic residues, such as poly(Lys), induce translation termination and destruction of the nascent polypeptide. Explain how this response would protect cells from the effect of faulty transcription that produces mRNAs with mutated Stop codons.

Why do frameshift mutations occur with the insertion or deletion of one or two, but not three, nucleotides?

All cells contain an enzyme called peptidyl-tRNA hydrolase, and cells that are deficient in the enzyme grow very slowly. What is the probable function of the enzyme and why is it necessary?
See all solutions

Recommended explanations on Biology Textbooks

Control of Gene Expression

Read Explanation

Biological Structures

Read Explanation

Microbiology

Read Explanation

Energy Transfers

Read Explanation

Reproduction

Read Explanation

Chemistry of Life

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free