Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 27: Q1P (page 1030)

Could a single nucleotide deletion restore the function of a protein-coding gene interrupted by the insertion of a 4-nt sequence? Explain.

Short Answer

Expert verified

The 4-nucleotide insertion may not restore the function of a protein-encoding gene.

Step by step solution

01

Definition of Concept

One of the structural elements or building blocks of DNA and RNA is the nucleotide.A nucleotide is made up of a base (one of the four substances adenine, thymine, guanine, and cytosine), a sugar molecule, and a phosphoric acid molecule.

02

Restoration of the single nucleotide deletion function of a protein-coding gene interrupted by the insertion of a 4-nt sequence

The addition of a 4-nucleotide sequence will result in the addition of one more codon, causing a shift in the reading frame. It can cause the insertion of a Stop codon early in the gene, which will not restore gene function. The insertion can interrupt the function of amino acids. It can also create a codon that can break the structure of amino acids. The site of nucleotide insertion and one nucleotide deletion can differ, which will interrupt the restoration of gene function.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

It has been proposed that residue A2486 is protonated and therefore stabilizes the tetrahedral reaction intermediate. Is this mechanistic embellishment consistent with the observed pH effect (Problem 27)? Explain.

EF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same efficiency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.

Aminoacyl–tRNA

Dissociation Constant (nM)

Ala–tRNAAla

6.2

Gln–tRNAAla

0.05

Gln–tRNAGln

4.4

Ala–tRNAGln

260

A double stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).

AGATCGGATGCTCAACTATATATGTGATTAACAGAGCATGCG-GCATAAACT

(a). Identify the DNA sequence that encodes each peptide.

(b). Determine the amino acid sequence of each peptide.

(c). In a mutual viral strain, the T at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

The rate of the peptidyl transferase reaction increases as the pH increases from 6 to 8. Explain these results in terms of its reaction mechanism.

Summarize the role of GTP hydrolysis in promoting the efficiency of translation initiation, decoding, translocation, and chain termination.
See all solutions

Recommended explanations on Biology Textbooks

Reproduction

Read Explanation

Biological Organisms

Read Explanation

Cell Cycle

Read Explanation

Heredity

Read Explanation

Ecology

Read Explanation

Ecological Levels

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free