A double stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).

AGATCGGATGCTCAACTATATATGTGATTAACAGAGCATGCG-GCATAAACT

(a). Identify the DNA sequence that encodes each peptide.

(b). Determine the amino acid sequence of each peptide.

(c). In a mutual viral strain, the T at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

Short Answer

Expert verified

(a)The Vir A peptide DNA sequence is:

AGATCGGATGCTCAACTATATGTGATTAAC

The Vir B peptide DNA sequence is:

AGAGCATGCGGCATA

(b)The amino acid sequence for the given peptide DNA sequence is:

Vir A:

Arginine-serine-aspartic acid-alanine-glutamine-leucine-tyrosine-valine-isoleucine-aspargine.

AGAUCGGAUGCUCAACUAUAUGUGAUUAAC

Vir B:

Arginine-Alanine-Cysteine-Glycine-Isoleucine

AGAGCAUGCGGCAUA

(c)In the mutant strain, T is replaced by G in the sequence. This leads to a conversion of valine amino acid to glycine in the first peptide whereas the second peptide remains the same.

Peptide Vir A:

AGAUCGGAUGCUCAACUAUAUGGGAUUAAC

In this case U is replaced by G as there is no T in mRNA

Peptide Vir B:

AGAGCAUGCGGCAUA

Step by step solution

01

DNA fragmentation

DNA fragmentation is the segregation or splitting of DNA strands into pieces. It can happen spontaneously or can be performed intentionally by laboratory people or by cells.

02

Identifying the DNA sequence that encodes a peptide

(a)The Vir A peptide DNA sequence is:

AGATCGGATGCTCAACTATATGTGATTAAC

The Vir B peptide DNA sequence is:

AGAGCATGCGGCATA

(b)The amino acid sequence for the given peptide DNA sequence is:

Vir A:

Arginine-serine-aspartic acid-alanine-glutamine-leucine-tyrosine-valine-isoleucine-aspargine.

AGAUCGGAUGCUCAACUAUAUGUGAUUAAC

Vir B:

Arginine-Alanine-Cysteine-Glycine-Isoleucine

AGAGCAUGCGGCAUA

(c)In the mutant strain, T is replaced by G in the sequence. This leads to a conversion of valine amino acid to glycine in the first peptide whereas the second peptide remains the same.

Peptide Vir A:

AGAUCGGAUGCUCAACUAUAUGGGAUUAAC

In this case U is replaced by G as there is no T in mRNA

Peptide Vir B:

AGAGCAUGCGGCAUA

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.

Sign-up for free