Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 27: Q24CP (page 1024)

Which translation protein mimics RNA structures and why?

Short Answer

Expert verified

The translation proteins that mimic RNA structures are EF-G (Elongation Factor G) and RRF (Ribosomal Recycling Factor). The translation proteins mimic RNA structure, which helps them drive translocation and maintain cell viability.

Step by step solution

01

RNA structure

RNA (Ribonucleic acid) is generally found as a single-stranded structure; its structure comprises ribose sugar (pentose sugar), nitrogenous base, and phosphate. RNAs are classified into three types, mRNA, rRNA, and tRNA.

02

Step 2: Translation protein mimics RNA structure

The elongation factor (EG-G) is a protein with an elongated shape comprising five domains in which the three domains of EF-G mimic the shape of tRNA bound to EF-Tu. This mimicry or resemblance allows EF-G to drive translocation by inducing a conformational change in the ribosome and also through displacing the peptidyl–tRNA from the A site. Another translation protein named Ribosome recycling factor (RRF) is a near-perfect mimic of tRNA and is essential for disassembling the post-termination complex.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Which base pairings account for wobble at the third codon-anticodon position?

A double stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2).

AGATCGGATGCTCAACTATATATGTGATTAACAGAGCATGCG-GCATAAACT

(a). Identify the DNA sequence that encodes each peptide.

(b). Determine the amino acid sequence of each peptide.

(c). In a mutual viral strain, the T at position 23 has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are) most likely to be used this way?

An antibiotic named fixmycin, which you have isolated from a fungus growing on ripe passion fruit, is effective in curing several types of sexually transmitted diseases. In characterizing fixmycin’s mode of action, you have found that it is a bacterial translational inhibitor that binds exclusively to the large subunit of E. coli ribosomes. The initiation of protein synthesis in the presence of Fixmycin results in the generation of dipeptides that remain associated with the ribosome. Suggest a mechanism of fixmycin action.

Not all naturally occurring peptides are synthesized by ribosomes that decode messenger RNA. How does non-ribosomal peptide synthesis take place? How does it differ from polyketide synthesis? What are some functions of these peptides?
See all solutions

Recommended explanations on Biology Textbooks

Biology Experiments

Read Explanation

Organ Systems

Read Explanation

Chemistry of Life

Read Explanation

Biological Structures

Read Explanation

Plant Biology

Read Explanation

Cells

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free