Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 13: Problem 32

Why do some journals require the authors of articles describing DNA libraries to make those libraries available to other researchers?

Short Answer

Expert verified
Journals require DNA libraries to promote collaboration, ensure reproducibility, and facilitate shared resources.

Step by step solution

01

Understand the Purpose of DNA Libraries

DNA libraries are collections of DNA sequences that represent the genetic material of an organism. These libraries are crucial for various types of genetic research, including cloning, gene discovery, and functional analysis.
02

Promote Scientific Collaboration

One reason journals require authors to share their DNA libraries is to promote collaboration among scientists. By making libraries available, researchers can verify findings, reproduce experiments, and build upon existing work, leading to more rapid scientific progress.
03

Ensure Reproducibility of Results

Reproducibility is a cornerstone of scientific research. Making DNA libraries available allows other scientists to replicate studies and confirm that the reported results are accurate and reliable.
04

Facilitate Shared Resources

Making DNA libraries accessible ensures that valuable genetic resources are not limited to a single research group. This shared access is necessary to maximize the potential impact of the research and to avoid redundant efforts in creating similar libraries.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

genetic research
DNA libraries play a pivotal role in genetic research. These libraries are vast collections of DNA sequences that represent the genetic material of different organisms. They are essential tools for various types of genetic studies, including:
  • Cloning – where specific genes can be replicated.
  • Gene discovery – identifying genes responsible for certain traits or diseases.
  • Functional analysis – understanding the role and function of specific genes within an organism.
By having access to these libraries, scientists can uncover crucial information about genetic makeup and utilize it to advance our understanding of biology and medicine.
scientific collaboration
One significant reason journals require sharing DNA libraries is to foster scientific collaboration. When researchers share their libraries:
  • Other scientists can verify their findings by conducting similar experiments.
  • New experiments can build on existing work, leading to rapid scientific advancements.
  • Researchers from different institutions or countries can collaborate, combining their expertise and resources for more comprehensive studies.
This collaborative environment accelerates research, mitigates errors, and leads to groundbreaking discoveries that might not be possible in isolation.
reproducibility of results
Reproducibility is a fundamental aspect of scientific research. It refers to the ability of other researchers to obtain the same results using the same methods. By making DNA libraries available:
  • Scientists can repeat experiments to verify the accuracy of the original findings.
  • The scientific community gains confidence in the reliability of the reported data.
  • Discrepancies in research findings can be identified and addressed, ensuring the robustness of scientific conclusions.
Reproducibility helps maintain the integrity of scientific research and ensures that new discoveries are based on solid, reliable data.
shared resources
Sharing DNA libraries also means sharing valuable genetic resources. This approach has several benefits:
  • Reduces redundancy – there is no need for multiple groups to create similar libraries, saving time and resources.
  • Maximizes impact – accessible libraries enable more scientists to make use of the data, leading to broader research applications.
  • Equitable access – research groups with fewer resources can still benefit from high-quality genetic libraries, promoting inclusive scientific progress.
By making DNA libraries available to the global research community, we ensure that valuable genetic information is utilized to its fullest potential across various scientific fields.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Where did restriction endonucleases get their name?

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer \(5^{\prime}\) GCCTCCGGAGACCCATTGG \(3^{\prime}\) Reverse primer \(5^{\prime}\) TTCTAAGAAACTGTTAAGG \(3^{\prime}\) (b) Forward primer \(5^{\prime}\) GGGGCCCCTCACTCGGGGCCCC \(3^{\prime}\) Reverse primer \(5^{\prime}\) TCGGCGGCCGTGGCCGAGGCAG \(3^{\prime}\) (c) Forward primer 5 ' TCGAATTGCCAATGAAGGTCCG \(3^{\text {' }}\) Reverse primer \(5^{\prime}\) CGGACCTTCATTGGCAATTCGA \(3^{\prime}\)

Sometimes knowing the DNA sequence of a gene that codes for a protein does not tell you the amino acid sequence. Suggest several reasons why this is so.

Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.

Why is temperature control so important in the polymerase chain reaction?
See all solutions

Recommended explanations on Chemistry Textbooks

Kinetics

Read Explanation

Inorganic Chemistry

Read Explanation

Chemistry Branches

Read Explanation

Nuclear Chemistry

Read Explanation

Making Measurements

Read Explanation

Physical Chemistry

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free