Log out Go to App
Go to App

Learning Materials

Features

Discover

Chapter 23: Problem 2

Name two examples from each of the following classes of carbohydrates: monosaccharides, disaccharides, and polysaccharides.

Short Answer

Expert verified
Monosaccharides: glucose, fructose. Disaccharides: sucrose, lactose. Polysaccharides: starch, cellulose.

Step by step solution

01

Define Monosaccharides

Monosaccharides are the simplest form of carbohydrates and cannot be hydrolyzed into simpler sugars. Examples include glucose and fructose.
02

Define Disaccharides

Disaccharides are carbohydrates that are made up of two monosaccharide molecules bonded together. Examples include sucrose and lactose.
03

Define Polysaccharides

Polysaccharides are large molecules made up of multiple monosaccharide units. Examples include starch and cellulose.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Start your free trial

Over 30 million students worldwide already upgrade their learning with Vaia!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Monosaccharides
Monosaccharides are the most basic units of carbohydrates. They are simple sugars that cannot be broken down into simpler sugars through hydrolysis. These molecules usually have a structure that includes a single sugar unit. The most well-known monosaccharides are glucose and fructose.
Glucose is essential for energy production in our cells and is the primary source of energy for most living organisms.
Fructose, also known as fruit sugar, is found in many plants, where it is often bonded to glucose to form the disaccharide sucrose.
  • **Features of Monosaccharides**:
    • Single sugar units
    • Simple structure
    • Cannot be hydrolyzed further
Disaccharides
Disaccharides are carbohydrates composed of two monosaccharide molecules linked together by a glycosidic bond. This bond forms during a dehydration reaction, where a water molecule is released.
Some common disaccharides include sucrose and lactose. Sucrose, also known as table sugar, is a combination of glucose and fructose. It's widely used as a sweetener in various foods and beverages.
Lactose, the sugar found in milk, is made up of glucose and galactose. Many people need the enzyme lactase to properly digest lactose; without it, they may experience lactose intolerance.
  • **Features of Disaccharides**:
    • Two sugar units
    • Formed by glycosidic bonds
    • Involves dehydration synthesis
Polysaccharides
Polysaccharides are complex carbohydrates consisting of long chains of monosaccharide units. These long chains can be either branched or unbranched and serve various functions in living organisms.
Common polysaccharides include starch and cellulose.
Starch, a storage form of energy in plants, is composed of numerous glucose units. It is a major component of foods such as potatoes, rice, and wheat.
Cellulose, on the other hand, is a structural polysaccharide found in the cell walls of plants. It's also made of glucose units but has a different bonding pattern that makes it insoluble and tough, providing structural support to plants.
  • **Features of Polysaccharides**:
    • Long chains of sugar units
    • Can be branched or unbranched
    • Serve as energy storage or structural components

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What are the three components of a nucleotide?

The following sequence of bases might be found on the gene that codes for oxytocin, the human pituitary hormone: TACACAATGTAAGTTTTGACGGGGGACCCTATC a. What is the base sequence of the complementarystrand of DNA? b. What is the base sequence that would occur on a strand of mRNA transcribed from the oxytocin DNA sequence?

What is the human body’s storage form of each of the following? a. glucose b. lipids c. protein

What does ATP stand for? What is the role of ATP in living organisms?

Write a summary discussing what you have learned about the four major classes of organic compounds found in living organisms—carbohydrates, lipids, proteins, and nucleic acids. Include a description of how these organic molecules are used by the body.
See all solutions

Recommended explanations on Chemistry Textbooks

Ionic and Molecular Compounds

Read Explanation

Inorganic Chemistry

Read Explanation

Nuclear Chemistry

Read Explanation

Making Measurements

Read Explanation

Chemical Reactions

Read Explanation

Chemistry Branches

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.

Sign-up for free