The following sequence of bases might be found on the gene that codes for oxytocin, the human pituitary hormone: TACACAATGTAAGTTTTGACGGGGGACCCTATC a. What is the base sequence of the complementarystrand of DNA? b. What is the base sequence that would occur on a strand of mRNA transcribed from the oxytocin DNA sequence?

Short Answer

Expert verified
a. ATGTGTTACATTCAAAACTGCCCCCTGGGATAGb. AUGUGUUACAUUCAAAAACUGCCCCCUCCCUAUC

Step by step solution

01

Understanding DNA Base Pairing

The DNA bases pair specifically: Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G). For the given sequence, substitute each base with its complementary base.
02

Write the Complementary DNA Sequence

Using the base pairing rule, write the complementary DNA strand for the given sequence TACACAATGTAAGTTTTGACGGGGGACCCTATC. The complementary bases are:T -> AA -> TC -> GG -> CThus, the complementary DNA sequence is ATGTGTTACATTCAAAACTGCCCCCTGGGATAG.
03

Understanding mRNA Transcription

During transcription, mRNA is synthesized from the DNA template. In RNA, Thymine (T) is replaced by Uracil (U). So, for each base in the DNA template, write the complementary RNA base.
04

Write the mRNA Sequence

Using the base pairing rule for RNA transcription, write the mRNA sequence for the given DNA sequence TACACAATGTAAGTTTTGACGGGGGACCCTATC. Since A pairs with U, T pairs with A, C pairs with G, and G pairs with C, the mRNA sequence is AUGUGUUACAUUCAAAAACUGCCCCCUCCCUAUC.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Sequencing
DNA sequencing is the process of determining the exact order of nucleotides within a DNA molecule. Each nucleotide consists of a sugar, a phosphate group, and a base. The four bases are adenine (A), thymine (T), cytosine (C), and guanine (G). The sequence is crucial because it determines the genetic information carried by that DNA. By knowing the sequence, scientists can understand which proteins will be formed and how genetic traits are inherited.
Sequencing methods can be used to identify the genetic composition of different organisms, diagnose genetic disorders, and even tailor personalized medical treatments.
In the provided exercise, we start with a DNA sequence: TACACAATGTAAGTTTTGACGGGGGACCCTATC, then find its complementary DNA strand and the mRNA sequence transcribed from it.
mRNA Synthesis
mRNA (messenger RNA) synthesis occurs during the transcription process. This is when a segment of DNA is copied into mRNA by the enzyme RNA polymerase. The mRNA carries the genetic information from the DNA in the nucleus to the ribosomes in the cytoplasm, where proteins are made.
In DNA, the bases adenine (A), thymine (T), cytosine (C), and guanine (G) pair up in a specific way: A with T, and C with G. However, in RNA, thymine (T) is replaced by uracil (U), so the pairing changes to A with U, and C with G.
For example, using the base sequence in the exercise: TACACAATGTAAGTTTTGACGGGGGACCCTATC, the corresponding mRNA sequence would be AUGUGUUACAUUCAAAAACUGCCCCCUCCCUAUC. This mRNA sequence will then be used as a template to synthesize proteins.
Base Pairing Rules
Base pairing rules are essential for understanding DNA structure and function. In the DNA double helix, the bases pair up specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).
These rules ensure that during DNA replication, each new DNA molecule is an exact copy of the original. Similarly, during transcription, the mRNA is made accurately based on the template DNA strand.
  • A <-> T
  • C <-> G
  • In RNA: A <-> U
  • C <-> G
For the given DNA sequence: TACACAATGTAAGTTTTGACGGGGGACCCTATC, the complementary DNA strand is ATGTGTTACATTCAAAACTGCCCCCTGGGATAG, and the mRNA sequence is AUGUGUUACAUUCAAAAACUGCCCCCUCCCUAUC.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.

Sign-up for free