The following sequence of bases might be found on the gene that codes for oxytocin, the human pituitary hormone: TACACAATGTAAGTTTTGACGGGGGACCCTATC a. What is the base sequence of the complementarystrand of DNA? b. What is the base sequence that would occur on a strand of mRNA transcribed from the oxytocin DNA sequence?

DNA sequencing is the process of determining the exact order of nucleotides within a DNA molecule. Each nucleotide consists of a sugar, a phosphate group, and a base. The four bases are adenine (A), thymine (T), cytosine (C), and guanine (G). The sequence is crucial because it determines the genetic information carried by that DNA. By knowing the sequence, scientists can understand which proteins will be formed and how genetic traits are inherited.
Sequencing methods can be used to identify the genetic composition of different organisms, diagnose genetic disorders, and even tailor personalized medical treatments.
In the provided exercise, we start with a DNA sequence: TACACAATGTAAGTTTTGACGGGGGACCCTATC, then find its complementary DNA strand and the mRNA sequence transcribed from it.

mRNA (messenger RNA) synthesis occurs during the transcription process. This is when a segment of DNA is copied into mRNA by the enzyme RNA polymerase. The mRNA carries the genetic information from the DNA in the nucleus to the ribosomes in the cytoplasm, where proteins are made.
In DNA, the bases adenine (A), thymine (T), cytosine (C), and guanine (G) pair up in a specific way: A with T, and C with G. However, in RNA, thymine (T) is replaced by uracil (U), so the pairing changes to A with U, and C with G.
For example, using the base sequence in the exercise: TACACAATGTAAGTTTTGACGGGGGACCCTATC, the corresponding mRNA sequence would be AUGUGUUACAUUCAAAAACUGCCCCCUCCCUAUC. This mRNA sequence will then be used as a template to synthesize proteins.

Base pairing rules are essential for understanding DNA structure and function. In the DNA double helix, the bases pair up specifically: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G).
These rules ensure that during DNA replication, each new DNA molecule is an exact copy of the original. Similarly, during transcription, the mRNA is made accurately based on the template DNA strand.

• A <-> T
• C <-> G
• In RNA: A <-> U
• C <-> G

For the given DNA sequence: TACACAATGTAAGTTTTGACGGGGGACCCTATC, the complementary DNA strand is ATGTGTTACATTCAAAACTGCCCCCTGGGATAG, and the mRNA sequence is AUGUGUUACAUUCAAAAACUGCCCCCUCCCUAUC.