Question: Give an mRNA sequence that will code for the synthesis of angiotensin II

Asp-Arg-Val-Tyr-Ile-His-Pro-Phe

Short Answer

Expert verified

The mRNA sequence that will code for the synthesis of angiotensin II

Asp-Arg-Val-Tyr-Ile-His-Pro-Phe

Possible codon assignments according to the base triplet for the given mRNA sequence are:

AspArgValTyrIleHisProPhe
GAUCGUGUUUAUAUUCAUCCUUUU
GACCGCGUCUACAUCCACCCCUUC

CGAGUA
AUA
CCA

CGGGUG


CCG

Step by step solution

01

Definition of mRNA sequence

A sequence used as a template to assemble in order the chain of amino acids that form a protein is defined as an mRNA sequence.

02

Explanations

The codon message for Asp can be GAU and GAC,

For Arg, it can be CGU, CGC, CGA, and CGG

For Val, the message will be GUU, GUC, GUA, and UUC

For Tyr, it can be UAU and UAC

For Ile it can be AUU, AUC and AUA

For His message will be CAU and CAC

For Pro, it will be CCU, CCC, CCA, and CCG

Lastly, for Phe, it would be coded as UUU and UUC.

There can be many codes for the given amino acid-base sequence.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with Vaia!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.

Sign-up for free